Properties of ATP-sulfurylase from marine alga Porphyra yezoensis.
نویسندگان
چکیده
منابع مشابه
Isolation of porphyran-degrading marine microorganisms from the surface of red alga, Porphyra yezoensis.
Marine microorganisms degrading porphyran (POR) were found on the surface of thalli of Porphyra yezoensis. Fifteen crude microorganism groups softened and liquefied the surface of agar-rich plate medium. Among these, 11 microorganism groups degraded porphyran that consisted of sulfated polysaccharide in Porphyra yezoensis. Following isolation, 7 POR-degradable microorganisms were isolated from ...
متن کاملGeneration of 10,154 expressed sequence tags from a leafy gametophyte of a marine red alga, Porphyra yezoensis.
A total of 10,154 5'-end expressed sequence tags (EST) were established from the normalized and size-selected cDNA libraries of a marine red alga, Porphyra yezoensis. Among the ESTs, 2140 were unique species, and the remaining 8014 were grouped into 1127 species. Database search of the 3267 non-redundant ESTs by BLAST algorithm showed that the sequences of 1080 species (33.1%) have similarity t...
متن کاملIsolation and regeneration of transiently transformed protoplasts from gametophytic blades of the marine red alga Porphyra yezoensis
Despite the recent progress of transient gene expression systems in a red alga Porphyra yezoensis by particle bombardment, a stable transformation system has yet to establish in any marine red macrophytes. One of the reasons of the difficulty in genetic transformation in red algae is the lack of systems to select and isolate transformed cells from gametophytic blades. Thus, toward the establish...
متن کاملStructural features of a gene encoding the vacuolar H+-ATPase c subunit from a marine red alga, Porphyra yezoensis.
We report the nucleotide sequence of a gene encoding the c ('16 kDa') subunit of the vacuolar-type H+-ATPase (V-ATPase) from a marine red alga, Porphyra yezoensis. A cDNA clone was isolated from a leafy gametophyte cDNA library and analyzed for the sequence. The genomic DNA sequence was directly determined by nested PCR. The structural gene contained four introns within a coding sequence of 483...
متن کاملThe nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
ژورنال
عنوان ژورنال: NIPPON SUISAN GAKKAISHI
سال: 1988
ISSN: 1349-998X,0021-5392
DOI: 10.2331/suisan.54.1635